View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_247 (Length: 213)
Name: NF9533A_low_247
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_247 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 35496425 - 35496263
Alignment:
| Q |
24 |
aaatgaattggtaccgattatattctaccttaaatatgttaggtttacnnnnnnnnnnnnaatatatgttaggtttagtgatgagaacacaactatgttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35496425 |
aaatgaattggtaccgattatattctaccttaaatatgttaggtttactttttatt----aatatatgttaggtttagtgatgagaacacaactatgttt |
35496330 |
T |
|
| Q |
124 |
atctcactccnnnnnnngtttggatggaatttatctcactcccatagctagtagttagcaattttat |
190 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35496329 |
atctcactcctttttttgtttggatggaatttatctcactcccatagctagtagttagcacttttat |
35496263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University