View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_251 (Length: 211)
Name: NF9533A_low_251
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_251 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 64 - 185
Target Start/End: Complemental strand, 33092559 - 33092442
Alignment:
| Q |
64 |
tctcagttgtgtgtcgaaggtctacttgatgaatgcatgtcttaagactatatatggagcacgaaattgtctcgctcgtcactaagcaaaagaagaatca |
163 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
33092559 |
tctcagttgtgtgtcgaatgtctacttgatgaatgcatgtcttaagactata----gagcaaaaaattctctcgcttgtcactaagcaaaagaagaatca |
33092464 |
T |
|
| Q |
164 |
agtgaaatttgtgagagtccta |
185 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
33092463 |
agtgaaatttgtgagaatccta |
33092442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 1182284 - 1182174
Alignment:
| Q |
64 |
tctcagttgtgtgtcgaaggtctacttgatgaatgcatgtcttaagactatatatggagcacgaaattgtctcgctcgtcactaagcaaaagaagaatca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| || ||||||||||||||| |||||| |
|
|
| T |
1182284 |
tctcagttgtgtgtcgaaggtctacttgatgaatgcatgtcttaagac----tatggagcaaaaaattgtctcacttttcactaagcaaaagacgaatca |
1182189 |
T |
|
| Q |
164 |
agtgaaatttgtgag |
178 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1182188 |
agtgaaatttgtgag |
1182174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 33092648 - 33092602
Alignment:
| Q |
20 |
gttagattttgctttgagatccaataatatgatgatgtgaacattct |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092648 |
gttagattttgctttgagatccaataatatgatgatgtgaacattct |
33092602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University