View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_253 (Length: 210)
Name: NF9533A_low_253
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_253 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 30 - 185
Target Start/End: Complemental strand, 10559687 - 10559532
Alignment:
| Q |
30 |
tttcgtgttggcgatcgcgttcacacgccaaatttcaaatattagattcattttgactcatcctagtttgttgttgtgatacttgcaatcgctcatgcac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10559687 |
tttcgtgttggcgatcgcgttcacacgccaaatttcaaatattagattcattttgactcatcctagtttgttgttgtcatacttgcaatcgctcatgcac |
10559588 |
T |
|
| Q |
130 |
cacttttttctttgcaatttgattttgcatccatacacaagtgccctatattgttc |
185 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10559587 |
cacttttttttttgcaatttgattttgcatccatacgcaagtgccctatattgttc |
10559532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University