View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_261 (Length: 203)
Name: NF9533A_low_261
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_261 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 32096523 - 32096357
Alignment:
| Q |
16 |
gatatgaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgaga |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096523 |
gataagaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgaga |
32096424 |
T |
|
| Q |
116 |
gtgatgctttgttggagattgagtgtttgcatagagaaggattgttgcttgatgttatggtaatgtt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32096423 |
gtgatgctttgttggagattgagtgtttgcatagagaaggattgttgcttgacgttatggtaatgtt |
32096357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University