View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_262 (Length: 203)
Name: NF9533A_low_262
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_262 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 41 - 182
Target Start/End: Complemental strand, 28519269 - 28519128
Alignment:
| Q |
41 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519269 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttggcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
28519170 |
T |
|
| Q |
141 |
tagcttacggtattgatttttaaacaccaaaagtacttcatc |
182 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519169 |
taacttacggtattgatttttaaacaccaaaagtacttcatc |
28519128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 89 - 158
Target Start/End: Original strand, 12728763 - 12728832
Alignment:
| Q |
89 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggtattgatt |
158 |
Q |
| |
|
|||||||||| |||| ||||| ||||| |||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12728763 |
ttctcttagctgtcaatggtaatccaataaagtcccatgatcttgttgtgtgtagcttgcggtattgatt |
12728832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 152
Target Start/End: Complemental strand, 34291425 - 34291362
Alignment:
| Q |
89 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggta |
152 |
Q |
| |
|
|||||||||| |||| |||||| ||||| || | |||||||||||||||||||||||| ||||| |
|
|
| T |
34291425 |
ttctcttagctgtcaaaggtaatccaataaaatcccatgatcttgttgtgtgtagcttgcggta |
34291362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University