View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_263 (Length: 203)
Name: NF9533A_low_263
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_263 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 24637026 - 24636857
Alignment:
| Q |
16 |
gattcactttatgcaggcattatacagtgcctctcaacactggctattcccccaagatttatgaggttgacattgactcaggttgtgaccacacttgggt |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24637026 |
gattctctttatgcaggcattatacagtgcctctcaacactggctattcccccaagatttatgaggttgacattgactcagtttgtgaccacacttgggt |
24636927 |
T |
|
| Q |
116 |
tcagtgtgatgcaccatgtataggttttatcaaggtgaagtcaaacttagatcaggcatcattctgatgt |
185 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24636926 |
tcagtgtgatgcaccatgtaaaggttttatcaaggtgaagtcaaacttagatcaggcatcattctgatgt |
24636857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 22 - 185
Target Start/End: Complemental strand, 24715559 - 24715391
Alignment:
| Q |
22 |
ctttatgcaggcattatacagtgc---ctctcaacactggctattcccccaagatttatgaggttgacattgactcaggttgtgaccacacttgggttca |
118 |
Q |
| |
|
||||||||||||||| ||||||| || |||||| ||||||| || | ||| ||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24715559 |
ctttatgcaggcattgtacagtgtgatctatcaacattggctatgcctctaagctttatgacgttgacattgactcaggttgtgacagcacttgggttca |
24715460 |
T |
|
| Q |
119 |
gtgtgatg--caccatgtataggttttatcaaggtgaagtcaaacttagatcaggcatcattctgatgt |
185 |
Q |
| |
|
|||||||| |||| |||| ||||| ||||||| ||||||||||||||| | || ||||||||||||| |
|
|
| T |
24715459 |
gtgtgatgcacaccttgtaaaggttgcatcaaggcgaagtcaaacttagacctggtatcattctgatgt |
24715391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 23 - 141
Target Start/End: Complemental strand, 10330825 - 10330707
Alignment:
| Q |
23 |
tttatgcaggcattatacagtgcctctcaacactggctattcccccaagatttatgaggttgacattgactcaggttgtgaccacacttgggttcagtgt |
122 |
Q |
| |
|
|||||| ||| ||||||| || ||||||||| ||||||| | || ||| ||||||| |||| || ||||||||| |||||| |||||||||||||||| |
|
|
| T |
10330825 |
tttatgtaggtattatactgtctctctcaacattggctatcctccaaagctttatgaccttgatatcgactcaggtagtgacctcacttgggttcagtgt |
10330726 |
T |
|
| Q |
123 |
gatgcaccatgtataggtt |
141 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
10330725 |
gatgcaccatgtaaaggtt |
10330707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University