View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_58 (Length: 332)
Name: NF9533A_low_58
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_58 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 85 - 332
Target Start/End: Original strand, 13669429 - 13669676
Alignment:
| Q |
85 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669429 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
13669528 |
T |
 |
| Q |
185 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgttttcaagttcaagtc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669529 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgttttcaagttcaagtc |
13669628 |
T |
 |
| Q |
285 |
agtgagaagattgacagctattccattgcttgctgctgttaacaatga |
332 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669629 |
agtgagaagattaacagctattccattgcttgctgctgttaacaatga |
13669676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University