View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_60 (Length: 329)
Name: NF9533A_low_60
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_60 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 20 - 329
Target Start/End: Complemental strand, 19190619 - 19190310
Alignment:
| Q |
20 |
atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190619 |
atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg |
19190520 |
T |
|
| Q |
120 |
ccatatccaccaatactcgtacgccctccatcaccatatccacccccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190519 |
ccatatccaccaatactcgaacgccctccatcaccatatccaccaccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag |
19190420 |
T |
|
| Q |
220 |
aacggtcatcggaaccataaccaccaccaaaacgtccacctccatacccgctctcgttattattcccataaccaccaccggaacgaccattagaaccata |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190419 |
aacggtcatcggaaccataaccaccaccaaaacgtccacctccatacccgctctcgttattattcccataaccaccaccggaacgaccattagaaccata |
19190320 |
T |
|
| Q |
320 |
accaccacca |
329 |
Q |
| |
|
|||||||||| |
|
|
| T |
19190319 |
accaccacca |
19190310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University