View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_79 (Length: 298)
Name: NF9533A_low_79
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_79 |
 | |
|
| [»] scaffold0132 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0132 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: scaffold0132
Description:
Target: scaffold0132; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 130 - 275
Target Start/End: Complemental strand, 1930 - 1782
Alignment:
| Q |
130 |
tggtgttggttgttatgtcgcggatattgttttgattttttgtggttctttagtgtggtttgtgcagattcttaa---gttcttccgttgcttcatgttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1930 |
tggtgttggttgttatgtcgcggatattgttttgattttttgtggtgctttagtgtggtttgtgcagattcttaagacgttcttccgttgcttcatgttg |
1831 |
T |
|
| Q |
227 |
atcgggttagtcgggtgttggtttggttttaggtgttccagctatatac |
275 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1830 |
atcgggtaagtcgggtgttggtttgattttaggtgttccacctatatac |
1782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0132; HSP #2
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 130 - 275
Target Start/End: Complemental strand, 9890 - 9742
Alignment:
| Q |
130 |
tggtgttggttgttatgtcgcggatattgttttgattttttgtggttctttagtgtggtttgtgcagattcttaa---gttcttccgttgcttcatgttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9890 |
tggtgttggttgttatgtcgcggatattgttttgattttttgtggtgctttagtgtggtttgtgcagattcttaagacgttcttccgttgcttcatgttg |
9791 |
T |
|
| Q |
227 |
atcgggttagtcgggtgttggtttggttttaggtgttccagctatatac |
275 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
9790 |
atcgggtaagtcgggtgttggtttgattttaggtgttccacctatatac |
9742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University