View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_94 (Length: 292)
Name: NF9533A_low_94
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_94 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 6 - 140
Target Start/End: Complemental strand, 21832022 - 21831888
Alignment:
| Q |
6 |
ctaaataatactaataggatgcataatttcatgataatcagcattcgtctcttacatcaaatatggtatcaacaaaacaagttcatcttatagagatctc |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832022 |
ctaaatgatactaataggatgcataatttcatgataatcagcattcgtctcttacaccaaatatggtatcaacaaaacaagttcatcttatagagatctc |
21831923 |
T |
|
| Q |
106 |
ataaaccaaaaggagttcgaacttgaaataacctg |
140 |
Q |
| |
|
|| ||||| | |||||||||||||||||||||||| |
|
|
| T |
21831922 |
atcaaccacatggagttcgaacttgaaataacctg |
21831888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 179 - 286
Target Start/End: Complemental strand, 21831854 - 21831747
Alignment:
| Q |
179 |
ctttgtagaccgataaaaacatcaatgaggacattagatctcaaacatggtattaatggagtgatcaaataccacgatcgctttcgaggagggcacttgg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21831854 |
ctttgtagaccgataaaaacatcaatgaggacattagatctcaaacatggtattaatggagtgatcaaataccacgatggctttcgaggagggcacttgg |
21831755 |
T |
|
| Q |
279 |
ataccaag |
286 |
Q |
| |
|
|||||||| |
|
|
| T |
21831754 |
ataccaag |
21831747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University