View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533_high_3 (Length: 239)
Name: NF9533_high_3
Description: NF9533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 3 - 101
Target Start/End: Complemental strand, 25517974 - 25517876
Alignment:
| Q |
3 |
tggaggttttgaaatttgatgaaaattaaatgagaggttggttaagggtgaatgtttgaaacatgagaaataagggagaatccttagaaccctgtgaaa |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
25517974 |
tggaggttttggaatttgatgaaaattaaatgagaggttggttaagggtgaatgtttgaaacatgagagataagggagaatctttagaaccctgtgaaa |
25517876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University