View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533_low_9 (Length: 233)
Name: NF9533_low_9
Description: NF9533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 29690731 - 29690949
Alignment:
| Q |
1 |
acgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690731 |
acgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgcatt |
29690830 |
T |
|
| Q |
101 |
ctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690831 |
ctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaa |
29690930 |
T |
|
| Q |
201 |
cacctcgacctctctcgcc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29690931 |
cacctcgacctctctcgcc |
29690949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 29718243 - 29718461
Alignment:
| Q |
1 |
acgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718243 |
acgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgcatt |
29718342 |
T |
|
| Q |
101 |
ctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718343 |
ctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaa |
29718442 |
T |
|
| Q |
201 |
cacctcgacctctctcgcc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29718443 |
cacctcgacctctctcgcc |
29718461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 30827938 - 30827877
Alignment:
| Q |
1 |
acgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccct |
62 |
Q |
| |
|
|||| |||||| |||||| ||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30827938 |
acgaacttctcatcaaaatctctaatttcccattgaaacaactcacatcactcaaactccct |
30827877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University