View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9534_high_2 (Length: 222)
Name: NF9534_high_2
Description: NF9534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9534_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 216
Target Start/End: Complemental strand, 45095014 - 45094809
Alignment:
| Q |
10 |
tttggtggtgtgcaaaatgagaaggtagagaaaataccacgtggatgaggtacgaaaaatttacgatggagaaaggatgaggagggatggactttcggag |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45095014 |
tttggtggggtgcaaaatgagaaggtagaaaaaataccacgtggatgaggtacgaaaaatttacgatggagaaaggatgaggagggatggactttcggag |
45094915 |
T |
 |
| Q |
110 |
cattcatggtttcaacttcgtaatgttgggaaaataaggttcgaatttgttaatcaaccctaatcatttggtttctatcgtcattggtacataattctag |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45094914 |
cattcatggtttcaacttggtaatgttgggaaaataaggttggaatttgttaatcaaccctaatcatttggtttctatcgtca-tggtacataattctag |
45094816 |
T |
 |
| Q |
210 |
ttttgtc |
216 |
Q |
| |
|
||||||| |
|
|
| T |
45094815 |
ttttgtc |
45094809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University