View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9534_low_12 (Length: 222)

Name: NF9534_low_12
Description: NF9534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9534_low_12
NF9534_low_12
[»] chr2 (1 HSPs)
chr2 (10-216)||(45094809-45095014)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 216
Target Start/End: Complemental strand, 45095014 - 45094809
Alignment:
10 tttggtggtgtgcaaaatgagaaggtagagaaaataccacgtggatgaggtacgaaaaatttacgatggagaaaggatgaggagggatggactttcggag 109  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45095014 tttggtggggtgcaaaatgagaaggtagaaaaaataccacgtggatgaggtacgaaaaatttacgatggagaaaggatgaggagggatggactttcggag 45094915  T
110 cattcatggtttcaacttcgtaatgttgggaaaataaggttcgaatttgttaatcaaccctaatcatttggtttctatcgtcattggtacataattctag 209  Q
    |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
45094914 cattcatggtttcaacttggtaatgttgggaaaataaggttggaatttgttaatcaaccctaatcatttggtttctatcgtca-tggtacataattctag 45094816  T
210 ttttgtc 216  Q
    |||||||    
45094815 ttttgtc 45094809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University