View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9534_low_8 (Length: 351)
Name: NF9534_low_8
Description: NF9534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9534_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 7e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 5 - 198
Target Start/End: Original strand, 40537362 - 40537557
Alignment:
| Q |
5 |
gaggagcagagaacatcgagtgaaaaacaaacgaagcggccaagcctaaaagtcaccttatcgagtac--atagttccaacagccaacacgtggtcaaat |
102 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
40537362 |
gaggagcaaagaacatcgagtgaaaaacaaacgaagcggccaagcctaaaagtcaccttgtcgagtacatatagttccaacagccaacacgtggtcgaat |
40537461 |
T |
|
| Q |
103 |
aacgcaccttgtcagaatcattaatgacattcaacccnnnnnnnctcaaactctttcnnnnnnnacggaaaaactcaaactcgtgttttatttttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40537462 |
aacgcaccttgtcagaatcattaatgacattcaacccaaaaaaactcaaactctttctttttttacggaaaaactcaaactcgtgttttatttttt |
40537557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University