View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9534_low_9 (Length: 331)
Name: NF9534_low_9
Description: NF9534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9534_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 33939198 - 33939043
Alignment:
| Q |
1 |
ttgatgcaacaaagattcttttggtcatgtttgaatctttgttgaaattgtggtgatgaaataacatccagttctgtggtttctcccatgagtagttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33939198 |
ttgatgcaacaaagattcttttggtcatgtttgaatctttgttgaaattgtggtgatgaaataacatccagttctgtggtttctcccatgagtagttaac |
33939099 |
T |
|
| Q |
101 |
taactaactaggtcgagaaaatctaggttgttacaacgaggatctagaacttagtt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33939098 |
taactaactaggtcgagaaaatctaggttgttacaacgaggatctagaacttagtt |
33939043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 197 - 317
Target Start/End: Complemental strand, 33939029 - 33938909
Alignment:
| Q |
197 |
gaagggtagaactaagtttatttatttacctctgaaatgataaacacgatggttccaaagtctttgtgcttctctgttaccaggttatctttgactatgt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33939029 |
gaagggtagaactaagtttatttatttacctctgaaatgataaacacgatggttccaaagtctttgtgcttctctgttaccaggttatctttgactatgt |
33938930 |
T |
|
| Q |
297 |
atgtggttgaaagagaagaag |
317 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33938929 |
atgtggttgaaagagaagaag |
33938909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 105 - 149
Target Start/End: Complemental strand, 33907248 - 33907204
Alignment:
| Q |
105 |
taactaggtcgagaaaatctaggttgttacaacgaggatctagaa |
149 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
33907248 |
taactaggtcgagaaagtctaggttgttgtaactaggatctagaa |
33907204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University