View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9535_low_3 (Length: 207)
Name: NF9535_low_3
Description: NF9535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9535_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 21591620 - 21591799
Alignment:
| Q |
18 |
actatgggttgatgctcttaattaccaacaaggttggactattaaaaataccttaggttcccaaatgaaaaattacatgtacacaaatatttgttagtaa |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21591620 |
actatgggttgatgctctta----ccaacaaggttggactattaaaaataccttaggttcccaaatgaaaaattacatgtacacaaatatttgttagtaa |
21591715 |
T |
|
| Q |
118 |
ataaatattagaaatgaaaaattattctcgactgttaacttcnnnnnnngtgttgttatt---acaatctggttacctttgctt |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
21591716 |
ataaatattagaaatgaaaaattaatctcgactgttaacttctttttttgtgttgttattacaacaatctggttaccattgctt |
21591799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 83
Target Start/End: Original strand, 21596814 - 21596858
Alignment:
| Q |
39 |
ttaccaacaaggttggactattaaaaataccttaggttcccaaat |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
21596814 |
ttaccaacaaggttggactattaaaaatgcattaggttccgaaat |
21596858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University