View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9536_low_6 (Length: 244)
Name: NF9536_low_6
Description: NF9536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9536_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 10800078 - 10799844
Alignment:
| Q |
1 |
ccatagtgcaacaaagttggtttgtaagaggttcagtttggaccagagctcttttcttctaatgttactagttgaagcataaatggccgaaaaataaagg |
100 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10800078 |
ccatggtgcaacaaagttggttagtaagaggttcagtttggaccagagctcttttcttctaatgttactagttgaagcataaatggcagaaaaataaagg |
10799979 |
T |
 |
| Q |
101 |
tcaaggttatttacattgtaagagaaggcaatttgttggtcatctatatctaaaatagtggggttgagagagtttaagcaaaagcaccacaaattagggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10799978 |
tcaaggttatttacattgtaagagaaggcaatttgttggtcatctatatctaaaatagtggggttgagagattttaagcaaaagcaccacaaattagggt |
10799879 |
T |
 |
| Q |
201 |
gaagatttcctctcgaatcttgaaatttctgatga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
10799878 |
gaagatttcctctcgaatcttgaaatttctcatga |
10799844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University