View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9537_low_7 (Length: 244)
Name: NF9537_low_7
Description: NF9537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9537_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 5463058 - 5463294
Alignment:
| Q |
1 |
cttttcaattcaatcaattctgtgttgcttcagatttt-gtgaaattgagtgtttcatgtaattttcgaccctcgatcatactaattttgttgcttttct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||| ||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
5463058 |
cttttcaattcaatcaattctgtgttgcttcagaatttagtgaaattgtgtgtttcatgtaatcttcgaccctcgattacactaattttgttgtttttct |
5463157 |
T |
|
| Q |
100 |
aattcttgaatctgttctcaaattttaattagatttttt-gtattgttt-catatgatcagttgtggtctatctatatgttggaattgaaaggaacggtg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5463158 |
aattcttgaatctgttctcaaattttaattagatttttttgtattgttttcatatcatcagttgtggtctatctatatgttggaattgaaaggaacggtg |
5463257 |
T |
|
| Q |
198 |
gcagaagcagcatccgaatgtctctcctcaatctctg |
234 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5463258 |
gcagaagcagcatccgaatgtctgtcctcaatctctg |
5463294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University