View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9537_low_8 (Length: 241)
Name: NF9537_low_8
Description: NF9537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9537_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 26036732 - 26036911
Alignment:
| Q |
18 |
aattgaaaactgtaagaattacttaaggtctcaattaagcatgtccaattactaacatattgaaaactggaagcaaaataatcaaatggcaaagtagctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26036732 |
aattgaaaactgtaagaattacttaaggtctcaattaagcatatccaattactaacatattgaaaactgaaagcaaaataatcaaatggcaaagtagctc |
26036831 |
T |
 |
| Q |
118 |
tggaaactcgaatgtcataacattgttggttctgtgatatagactaggatctgaatgtatcaaagaaataagagaaactt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26036832 |
tggaaactcgaatgtcataacattgttggtcctgtgatatagactaggatctgaatgcatcaaagaaataagagaaactt |
26036911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University