View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9538_low_3 (Length: 241)
Name: NF9538_low_3
Description: NF9538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9538_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 38080797 - 38080587
Alignment:
| Q |
13 |
attatacttacaagtggagccttagagaggtaactgaggatggttgcaacagcatggaatgaatgaaacttgtcctatnnnnnnnnnnnncagcaataga |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
38080797 |
attagacttacaagtggagccttagagaggtaactgaggatggttgcaacagcatggaatgaatgaaacttgtcctataaaaataataaacagcaacaga |
38080698 |
T |
|
| Q |
113 |
tttagctcacagttttttaataattgaataaacataacagtttaagcaacaatagataatgacctcttgttcagatttgaactggattctagtgctaagt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38080697 |
tttagctcacagttttttaataattgaataaacataacagtttaagcaacaatagataatgacctcttgttcagatttgaactggattctagtgctaagt |
38080598 |
T |
|
| Q |
213 |
tcagcaagaag |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
38080597 |
tcagcaagaag |
38080587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 223
Target Start/End: Complemental strand, 39700170 - 39700129
Alignment:
| Q |
182 |
ttcagatttgaactggattctagtgctaagttcagcaagaag |
223 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
39700170 |
ttcagatttaaactgaattctagtgctaagctcagcaagaag |
39700129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University