View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9540_low_12 (Length: 217)
Name: NF9540_low_12
Description: NF9540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9540_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 40084702 - 40084890
Alignment:
| Q |
13 |
agcataggtgatatttgaccagataaccggttaaagctaagatcaacggttggaattgcaacttgatccaccggttcaactgaaccggtaaactggtttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40084702 |
agcataggtgatatttgaccagataaccggttaaagctaagatcaacggttggaattgcaacttgatccaccggttcaactgaaccggtaaactggtttc |
40084801 |
T |
|
| Q |
113 |
tttctaattggagatttgtcagtgggaatgagaataccttacccggaagaggtccagtgaattggttcagactcaggtctaaatagttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40084802 |
tttctaattggagatttgtcagtgggaatgagaataccttacccggaagaggtccagtgaattggttcagactcaggtctaaatagttt |
40084890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University