View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9541_low_6 (Length: 283)
Name: NF9541_low_6
Description: NF9541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9541_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 90 - 260
Target Start/End: Complemental strand, 47437441 - 47437271
Alignment:
| Q |
90 |
ccataaagactgtttttaacttcagttttgacatatcataaaatacaccgtgaggtttgaagaaacatagtgacgtaaaataatatatatcacacaagca |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47437441 |
ccataaagactgtttttaacttcagttttgacatatcataaaattcaccgtgaggtttgaagaaacatagtgacgtaaaataatatatatcacacaagca |
47437342 |
T |
 |
| Q |
190 |
tgtctggtcttnnnnnnnnnnnngatccaagcaattttgatcttcattacacgcaacttcaagcacaacaa |
260 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47437341 |
tgtctggtcttgaaaaagaaaaagatccaagcaattttgatctttattacacgcaacttcaagcacaacaa |
47437271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University