View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9541_low_7 (Length: 250)
Name: NF9541_low_7
Description: NF9541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9541_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 34175647 - 34175881
Alignment:
| Q |
1 |
tactaggaactaacagtccaataattatatgatagttgttatcnnnnnnnn-ttggtctatccatgaattagtcaaagtgataagagatttgaacccctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34175647 |
tactaggaactaacagtccaataattatatgatagttgttatcaacaaaaaattggtctattcatgaattagtcaaagtgataagagatttgaacccctt |
34175746 |
T |
 |
| Q |
100 |
aaacaagtggtcataggtttgttatgcgactcttgcgtatggaagaacacatcttttattgagattgatcactattaaacaacaatgaaaacttcatact |
199 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34175747 |
aaacaagtgatcataggtttattatgcgactcttgcgtatggaagaacacatcttttattgaaattgatcactattaaacaacagtgaaaacttcatact |
34175846 |
T |
 |
| Q |
200 |
gataacatgataaaagaaatatatcatattatagc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34175847 |
aataacatgataaaagaaatatatcatattatagc |
34175881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University