View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9541_low_8 (Length: 239)
Name: NF9541_low_8
Description: NF9541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9541_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 34175532 - 34175418
Alignment:
| Q |
1 |
cattttgattttattagtataatattttcattttgtttctatcttttggcacctccgtaaccttacctgtcctatgaggtattgaggtgtatgtggtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34175532 |
cattttgattttattagtataatattttcattttgtttctatcttttggcacctccgtaaccttacctctcctatgaggtattgaggtgtatgtggtttt |
34175433 |
T |
 |
| Q |
101 |
aataaaatttgatta |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34175432 |
aataaaatttgatta |
34175418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 34175346 - 34175297
Alignment:
| Q |
174 |
gctcctctcatcacatctcattccattcatcaacttgattcactaattat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34175346 |
gctcctctcatcacatctcattccattcatcaacttgattcactaattat |
34175297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University