View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9542_4 (Length: 458)
Name: NF9542_4
Description: NF9542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9542_4 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 28656912 - 28656757
Alignment:
| Q |
1 |
taggcatgtctccgtctccgacacgtgttgtgtctgacactcattcaacacgtgtccattaattcagacaagtgtcccgaaaaatatcattttttctttg |
100 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||| |||||||| || ||||||||||| |||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
28656912 |
taggcatgtctctatctccaacattcgttgtgtttgacactccgtcgacacgtgtccaacaattcagacaagtgtcccaaacaatatcattttttctttg |
28656813 |
T |
 |
| Q |
101 |
ctttaacacaccgtaaacacttcttggatacatctcagacacatctatggaagttt |
156 |
Q |
| |
|
|||| |||||||||||||||| |||||| |||||||||||||||||| | |||||| |
|
|
| T |
28656812 |
ctttgacacaccgtaaacactccttggacacatctcagacacatctacgaaagttt |
28656757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 315
Target Start/End: Complemental strand, 28656513 - 28656464
Alignment:
| Q |
267 |
tgtcaggtgt-gcttcatagatcacaacactcgctccctaataccactcc |
315 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28656513 |
tgtcaggtgttgcttcatagatcacaacactccctccctaataccactcc |
28656464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 191
Target Start/End: Complemental strand, 28656672 - 28656641
Alignment:
| Q |
160 |
gatgaatgaagatgaaagactatcatatcatg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28656672 |
gatgaatgaagatgaaagactatcatatcatg |
28656641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 429
Target Start/End: Original strand, 34595090 - 34595119
Alignment:
| Q |
400 |
ctatgaagcacggacaccggacacgacacg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34595090 |
ctatgaagcacggacaccggacacgacacg |
34595119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 390 - 429
Target Start/End: Original strand, 13414423 - 13414462
Alignment:
| Q |
390 |
tgatgaatatctatgaagcacggacaccggacacgacacg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13414423 |
tgatgaatatctatgaagcacggacaccagacacgacacg |
13414462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 428
Target Start/End: Complemental strand, 41961753 - 41961725
Alignment:
| Q |
400 |
ctatgaagcacggacaccggacacgacac |
428 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41961753 |
ctatgaagcacggacaccggacacgacac |
41961725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 429
Target Start/End: Original strand, 241548 - 241579
Alignment:
| Q |
398 |
atctatgaagcacggacaccggacacgacacg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
241548 |
atctatgaagcacggacaccggacacgacacg |
241579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 66 - 145
Target Start/End: Original strand, 43837105 - 43837183
Alignment:
| Q |
66 |
agacaagtgtcccgaaaaatatcattttttctttgctttaacacaccgtaaacacttcttggatacatctcagacacatc |
145 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||||||| |||||||| || || || ||||||| ||||||| ||||||| |
|
|
| T |
43837105 |
agacaagtatcccagaaaatat-attttttctttgcttcaacacaccttatactctccttggatgcatctcaaacacatc |
43837183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 429
Target Start/End: Complemental strand, 38804646 - 38804617
Alignment:
| Q |
400 |
ctatgaagcacggacaccggacacgacacg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38804646 |
ctatgaagcacggacaccggacacgacacg |
38804617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 429
Target Start/End: Original strand, 12242517 - 12242546
Alignment:
| Q |
400 |
ctatgaagcacggacaccggacacgacacg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12242517 |
ctatgaagcacggacaccggacacgacacg |
12242546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 159 - 187
Target Start/End: Original strand, 15578668 - 15578696
Alignment:
| Q |
159 |
agatgaatgaagatgaaagactatcatat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15578668 |
agatgaatgaagatgaaagactatcatat |
15578696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University