View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9542_low_1 (Length: 258)
Name: NF9542_low_1
Description: NF9542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9542_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 29 - 248
Target Start/End: Complemental strand, 11198269 - 11198050
Alignment:
| Q |
29 |
catacaactttgtgtacaataaaatgcaattggggacaagtttcacggtaaaagtattgatctaatagtgcatttgagaacaaaggtaaccctccaagaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11198269 |
catacaactttgtgtacaataaaatgcaattggggacaagtttcacggtaaaagtattgatctaattgtgcatttgagaacaaaggtaaccctccaagaa |
11198170 |
T |
|
| Q |
129 |
caaccactgcatagatcatttttctctctaaaattaattttaaattgtgtgnnnnnnnnnnnngcgagaattaacatgtagtgaaccttaacttaaagag |
228 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11198169 |
caaccactacatagatcatttttctctctaaaattaattttaaattgtgtgttttttgtttttgcgagaattaacatgtagtgaaccttaacttatagag |
11198070 |
T |
|
| Q |
229 |
ttatgtggccatggcctttg |
248 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11198069 |
ttatgtggccatggcctttg |
11198050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University