View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9543_high_6 (Length: 220)

Name: NF9543_high_6
Description: NF9543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9543_high_6
NF9543_high_6
[»] chr1 (1 HSPs)
chr1 (1-220)||(32795440-32795658)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 32795440 - 32795658
Alignment:
1 taaataattatcgtcgtagtatgtgttagaaaatcactgcaaaacttactaaaaagaagattaagacaaaaatggtggtttcacatgaactctgaaatgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||    
32795440 taaataattatcgtcgtagtatgtgttagaaaatcactgcaaaacttactaaagagaagattaagacgaaaatggtggtttcacatgaactctgaaatgt 32795539  T
101 gcgtggacgacaaactaaactttagattcggtttatccccaatcaatttatgcaaaccggatgtaaattgaaaattttgcaaatctcttttacgatatat 200  Q
    | |||||||||||||||||||||||| || ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32795540 gtgtggacgacaaactaaactttagactctgttca-ccccaatcaatttatgcaaaccggatgtaaattgaaaattttgcaaatctcttttacgatatat 32795638  T
201 tggaatccttagcatgaatt 220  Q
    ||||||||||||||||||||    
32795639 tggaatccttagcatgaatt 32795658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University