View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9543_low_12 (Length: 254)
Name: NF9543_low_12
Description: NF9543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9543_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 254
Target Start/End: Complemental strand, 32796241 - 32796003
Alignment:
| Q |
12 |
aagcaaagaagttagttgtcggatcaaaaggtgcaaattttattaatacataagttgcataaagaaagaatctctaagtatatgaagagtagtttcattc |
111 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
32796241 |
aagcagagaagttagttgtccgatcaaaaggtgtaaattttattaatacataagttgcataaagaa----tctctaagtacatgaagagtagtttcattc |
32796146 |
T |
 |
| Q |
112 |
tccatccaataggggcccaaaccccacataatgtgaagaattttcaaaatatgtgaagaaccctatgatgttgaaaggacttgtttggtctagtggtttg |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32796145 |
tccatcctataggggcccaaaccccacataatgtgaagaattttcaaaatatgtgaagaaccttgtgatgttgaaaggacttgtttggtctagtggtttg |
32796046 |
T |
 |
| Q |
212 |
atagttgttcggtcatggggtcgattttgttcaaccacaaatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32796045 |
atagttgttcggtcatggggtcgattttgttcagccacaaatt |
32796003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University