View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9545_low_8 (Length: 254)
Name: NF9545_low_8
Description: NF9545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9545_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 113 - 254
Target Start/End: Original strand, 22080442 - 22080583
Alignment:
| Q |
113 |
acaatatcatcaaaaacaaaatagaaatgcagttcaatagatctttgatatgtctttgattaaaatgacttctgaaacaattttagttcgaaaaattgat |
212 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
22080442 |
acaatatcatcaaatacaaaacagaaatgcagttcaatagatctttgatacgtctttcattaaaatgacttctcaaacaattttagttcgaaaaactgat |
22080541 |
T |
 |
| Q |
213 |
ttaatgcaagaaggaaaaccgatctattgaaatgttgttcac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
22080542 |
ttaatgcaagaaggaaaaccgatctatttaagtgttgttcac |
22080583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University