View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9546_low_12 (Length: 288)
Name: NF9546_low_12
Description: NF9546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9546_low_12 |
 |  |
|
| [»] scaffold1694 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 4 - 112
Target Start/End: Original strand, 27999357 - 27999465
Alignment:
| Q |
4 |
ttgaggaggagcacagatactaaagtttcattggtttctgaggatcaacagcaagacaacgcaataatggtaaccatctcaccttcttctgtaatgttat |
103 |
Q |
| |
|
|||||||| | |||| ||||||||||| |||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27999357 |
ttgaggagtaccacaaatactaaagttccattggtttctgaggatcaacaacaagagaacgtaataatggtaaccatctcaccttcttatgtaatgttat |
27999456 |
T |
 |
| Q |
104 |
ttttatacc |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
27999457 |
ttttatacc |
27999465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 68 - 107
Target Start/End: Original strand, 11409601 - 11409640
Alignment:
| Q |
68 |
taatggtaaccatctcaccttcttctgtaatgttattttt |
107 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
11409601 |
taatggtaaccctctcaccttcttctgtgatgttattttt |
11409640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 50037354 - 50037311
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
50037354 |
ttgcatacattatgcattgtccataccaactgagctaagctcac |
50037311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 249
Target Start/End: Complemental strand, 20276086 - 20276052
Alignment:
| Q |
215 |
atgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20276086 |
atgcattgtccatatcaactaagctaaactcacaa |
20276052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 245
Target Start/End: Complemental strand, 46483291 - 46483249
Alignment:
| Q |
203 |
tttgcatacaatatgcattgtccatatcaactaagctaagctc |
245 |
Q |
| |
|
|||||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
46483291 |
tttgcatatattatgcattgtccataccaactaagctaagctc |
46483249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Original strand, 20370309 - 20370342
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
20370309 |
tatgcattgtccatatcaactgagctaagctcac |
20370342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 53996342 - 53996297
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
53996342 |
ttgcatatattatgcattgtccataccaactgagctaagctcacaa |
53996297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 247
Target Start/End: Complemental strand, 15881122 - 15881090
Alignment:
| Q |
215 |
atgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
15881122 |
atgcattgtccatatcaacttagctaagctcac |
15881090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 247
Target Start/End: Original strand, 27999714 - 27999758
Alignment:
| Q |
203 |
tttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||| |||||||||||| |
|
|
| T |
27999714 |
tttgcatacaatacgcattatccataccaactgagctaagctcac |
27999758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 247
Target Start/End: Original strand, 52453274 - 52453318
Alignment:
| Q |
203 |
tttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
|||||||| | |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
52453274 |
tttgcatatattatgcattgtccctattaactaagctaagctcac |
52453318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 107
Target Start/End: Complemental strand, 9329386 - 9329313
Alignment:
| Q |
31 |
tcattggtttctgaggatcaacagcaagacaacgcaataatggtaaccatctcaccttcttctgtaatgttattttt |
107 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| |||||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
9329386 |
tcattggtttctgaggatcaaccgcaggacaac---ataatggtaaccctcttaccttcttctgtgatgttattttt |
9329313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 107
Target Start/End: Complemental strand, 9383169 - 9383096
Alignment:
| Q |
31 |
tcattggtttctgaggatcaacagcaagacaacgcaataatggtaaccatctcaccttcttctgtaatgttattttt |
107 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| |||||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
9383169 |
tcattggtttctgaggatcaaccgcaggacaac---ataatggtaaccctcttaccttcttctgtgatgttattttt |
9383096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 36490611 - 36490568
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
36490611 |
ttgcatacattatgcattgtccataccaactaagttaagctcac |
36490568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Original strand, 16743302 - 16743347
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
16743302 |
ttgcatatattatgcattatccatatcaactgagctaagctcacaa |
16743347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 19854608 - 19854563
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
19854608 |
ttgcatatattatgcattgtccataccaactgagctaagctcacaa |
19854563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Original strand, 39171398 - 39171431
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
39171398 |
tatgcattgtccatatcaactgagctaagctcac |
39171431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Original strand, 43374300 - 43374333
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
43374300 |
tatgcattgtccatatcaactgagctaagctcac |
43374333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 246
Target Start/End: Complemental strand, 9196246 - 9196214
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctca |
246 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
9196246 |
tatgcattgtccatatcaactaagttaagctca |
9196214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 20383531 - 20383487
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcaca |
248 |
Q |
| |
|
||||||| | ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20383531 |
ttgcatatattatgcattgtccataccaactgagctaagctcaca |
20383487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 31038540 - 31038583
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
31038540 |
ttgcatacaatatgcattgtccataccaactgagctaagctcac |
31038583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 247
Target Start/End: Original strand, 35142166 - 35142210
Alignment:
| Q |
203 |
tttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
35142166 |
tttgcatatattatgcattgtccatatcaactgagctaagctcac |
35142210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 41527603 - 41527560
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
41527603 |
ttgcatatattatgcattgtccataccaactaagctaagctcac |
41527560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 245
Target Start/End: Original strand, 44473338 - 44473369
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44473338 |
tatgcattgtccatatcaactaagctaagctc |
44473369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 16967212 - 16967255
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
16967212 |
ttgcatatattatgcattgtccatatcaactaagctaagctcac |
16967255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 32944779 - 32944734
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32944779 |
ttgcatatattatgcattgtccataccaactaagctaagctcacaa |
32944734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 43021647 - 43021689
Alignment:
| Q |
205 |
tgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
43021647 |
tgcataaaatatgcattgtccctaccaactaagctaagctcac |
43021689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 8253782 - 8253737
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
8253782 |
ttgcatatattatgcattgtccataccaactgagctaagctcacaa |
8253737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 13054916 - 13054871
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | |||||||||||| || |||||||||||||||||||| |
|
|
| T |
13054916 |
ttgcatatattatgcattgtccctaccaactaagctaagctcacaa |
13054871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Original strand, 29701348 - 29701381
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
29701348 |
tatgcattgtccatatcaactaagttaagctcac |
29701381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 246
Target Start/End: Original strand, 13778841 - 13778873
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctca |
246 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
13778841 |
tatgcatcgtccatatcaactaagctaagctca |
13778873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 247
Target Start/End: Complemental strand, 26755648 - 26755616
Alignment:
| Q |
215 |
atgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
26755648 |
atgcattgtccatatcaactgagctaagctcac |
26755616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 10871912 - 10871955
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
10871912 |
ttgcatacattatgcattgtccataccaactaaactaagctcac |
10871955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 27718912 - 27718955
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
27718912 |
ttgcatatattatgcattgtccatatcaactgagctaagctcac |
27718955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 30427774 - 30427729
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
30427774 |
ttgcatatattatgcattgtccataccaactgagctaagctcacaa |
30427729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Complemental strand, 44655027 - 44654994
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
44655027 |
tatgcattgtctatatcaactaagctaagctcac |
44654994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 24485742 - 24485699
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24485742 |
ttgcatatattatgcattgtccataccaactaagctaagctcac |
24485699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 39610359 - 39610402
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
39610359 |
ttgcatatattatgcattgtccatatcaactgagctaagctcac |
39610402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 10515404 - 10515359
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
10515404 |
ttgcatatattattcattgtccatatcaactaagttaagctcacaa |
10515359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Complemental strand, 22394068 - 22394035
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
22394068 |
tatgcattgtccatatcaactgagctaagctcac |
22394035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 33064029 - 33063986
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
33064029 |
ttgcatatattatgcattgtccatatcaactgagctaagctcac |
33063986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Original strand, 9799438 - 9799471
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
9799438 |
tatgcattgtccatttcaactaagctaagctcac |
9799471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 29734734 - 29734689
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaagctcacaa |
249 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
29734734 |
ttgcatatattatgcattgtccatatcaactgagctaaactcacaa |
29734689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Original strand, 41187485 - 41187518
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
41187485 |
tatgcattgtccataccaactaagctaagctcac |
41187518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Original strand, 41204529 - 41204562
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
41204529 |
tatgcattgtccataccaactaagctaagctcac |
41204562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1694 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1694
Description:
Target: scaffold1694; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 242
Target Start/End: Complemental strand, 198 - 160
Alignment:
| Q |
204 |
ttgcatacaatatgcattgtccatatcaactaagctaag |
242 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
198 |
ttgcatacattatgcattgtccatatcaactgagctaag |
160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Complemental strand, 244512 - 244479
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
244512 |
tatgcattgtccatatcaactgagctaagctcac |
244479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 247
Target Start/End: Complemental strand, 16130798 - 16130765
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcac |
247 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
16130798 |
tatgcattgtccataccaactaagctaagctcac |
16130765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 24827085 - 24827048
Alignment:
| Q |
214 |
tatgcattgtccatatcaactaagctaagctcacaatg |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
24827085 |
tatgcattgtccatatcaactgagctaagctaacaatg |
24827048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University