View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9546_low_15 (Length: 242)
Name: NF9546_low_15
Description: NF9546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9546_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 9 - 191
Target Start/End: Original strand, 5020080 - 5020262
Alignment:
| Q |
9 |
tggtgttttactttttcaactatacatggaatatagaatggactaagttaaaatgttatgggatttttacgactttggttcatatttttaataattttga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5020080 |
tggtgttttactttttcaactatacatggaatatagaatggactaagttaaaatgttatgggatttttacgactttggttcatatttttaataattttga |
5020179 |
T |
 |
| Q |
109 |
ataaaaatgataaacaatgaaatcttattctcaatgctctatcacaagtcatgcaatcttgtctcagttccatgaaatatttc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5020180 |
ataaaaatgataaacaatgaaatcttattctcaatgctctatcacaagtcatgcaatcttgtctcagttccatgaaatatttc |
5020262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University