View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9546_low_17 (Length: 234)

Name: NF9546_low_17
Description: NF9546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9546_low_17
NF9546_low_17
[»] chr3 (1 HSPs)
chr3 (15-220)||(36467698-36467903)


Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 36467698 - 36467903
Alignment:
15 cacagaggatgaagctacggagttttatgtattgtttgcaaaataccacgggtttgaagtaagaaaggatgatgtgaaacgttattctaatgggaacatt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467698 cacagaggatgaagctacggagttttatgtattgtttgcaaaataccacgggtttgaagtaagaaaggatgatgtgaaacgttattctaatgggaacatt 36467797  T
115 attatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggttgtgtgcgttttctacttgga 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467798 attatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggttgtgtgcgttttctacttgga 36467897  T
215 tctgtg 220  Q
    ||||||    
36467898 tctgtg 36467903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University