View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9548_high_5 (Length: 254)
Name: NF9548_high_5
Description: NF9548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9548_high_5 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 197 - 254
Target Start/End: Complemental strand, 1703213 - 1703156
Alignment:
| Q |
197 |
ctcactattaattaattttaagtaaaaatttgtctggttatataacaaataatatttt |
254 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1703213 |
ctcactattaattaaatttaagtaaaaatttgtctggttatataacaaataatatttt |
1703156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 1703394 - 1703338
Alignment:
| Q |
19 |
tttgtgtaatgaaattattatggcattctatgttaaaatatgtattttagttccttc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1703394 |
tttgtgtaatgaaattattatggcattctatgttaaaatatgtatgttagttccttc |
1703338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University