View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9548_low_16 (Length: 206)
Name: NF9548_low_16
Description: NF9548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9548_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 28813695 - 28813492
Alignment:
| Q |
1 |
tgctaataattacaaggtttaatttctgcttctatttaaacattcttttgtagcatcttgagtagcttgaaaatattgtattggtcttaaggnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28813695 |
tgctaataattacaaggtttaatttctgcttctatttaaacattcttttgtagcatcttgagtagcttgaaaatattgtattggtcttaaggttttttgt |
28813596 |
T |
|
| Q |
101 |
nnnnnnncagtgcacaatatggttgcttttggcaagaagttgagagaatcacagattcaagaatggaaagggtaacaatattcatgcttttttcctttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28813595 |
atttttttagtgcacaatatggttgcttttggcaagaagttgagagaatcacagattcaagaatggaaagggtaacaatattcatgcttttttcttttga |
28813496 |
T |
|
| Q |
201 |
ttct |
204 |
Q |
| |
|
|||| |
|
|
| T |
28813495 |
ttct |
28813492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University