View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9549_low_26 (Length: 283)
Name: NF9549_low_26
Description: NF9549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9549_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 269
Target Start/End: Original strand, 25204514 - 25204764
Alignment:
| Q |
19 |
atatcatccttagaaacttctaaggaaagaatcattgtaggattgttaatgaattggcaaaggcaatcggatgaattagttaccatctcctttaaagggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25204514 |
atatcatccttagaaacttctaaggaaagaatcattgtaggattgttaataaattggcaaaggcaatcggatgaattggttaccatctcctttaaagggt |
25204613 |
T |
 |
| Q |
119 |
cacaacatgttggaggaggatcatttggagccttcaaaaatggttgacaaggaagcaattggtgcatgcattgtgcatttgcaattgcattttgtccaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25204614 |
cacaacatgttggaggaggatcatttggagccttcaaaaatggttgacaaggaagcaattggtgcatgcattgtgcatttgcaattgcattttgtccaag |
25204713 |
T |
 |
| Q |
219 |
gccaggaagaatttggtcaagatcgacgctgccgctgccgccaccgccgtc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25204714 |
gccaggaagaatttggtcaagatcgacgctgccgctgccgccaccgccgtc |
25204764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University