View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9549_low_36 (Length: 228)
Name: NF9549_low_36
Description: NF9549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9549_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 85 - 206
Target Start/End: Complemental strand, 40566225 - 40566104
Alignment:
| Q |
85 |
ggaacagtagtttaaataaggtgctttataattttttattgaactcaaattgttatctaagagaaactcttacttagacacaactctaaattttagttgg |
184 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| | |||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
40566225 |
ggaacagtagtttaaataaggtgttttacaattttttattgaactcaaattgttatcaaggagaaagtcttacttagatacaaccctaaattttagttgg |
40566126 |
T |
 |
| Q |
185 |
gattatgctcaattaagattta |
206 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40566125 |
gattatgctcaattaagattta |
40566104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University