View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9549_low_36 (Length: 228)

Name: NF9549_low_36
Description: NF9549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9549_low_36
NF9549_low_36
[»] chr8 (1 HSPs)
chr8 (85-206)||(40566104-40566225)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 85 - 206
Target Start/End: Complemental strand, 40566225 - 40566104
Alignment:
85 ggaacagtagtttaaataaggtgctttataattttttattgaactcaaattgttatctaagagaaactcttacttagacacaactctaaattttagttgg 184  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| | |||||| ||||||||||| ||||| |||||||||||||||    
40566225 ggaacagtagtttaaataaggtgttttacaattttttattgaactcaaattgttatcaaggagaaagtcttacttagatacaaccctaaattttagttgg 40566126  T
185 gattatgctcaattaagattta 206  Q
    ||||||||||||||||||||||    
40566125 gattatgctcaattaagattta 40566104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University