View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9549_low_37 (Length: 228)
Name: NF9549_low_37
Description: NF9549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9549_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 41734938 - 41735149
Alignment:
| Q |
1 |
gtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaaagtgtataaatactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734938 |
gtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaaagtgtataaatactct |
41735037 |
T |
 |
| Q |
101 |
accaaggttggcatatggtagattaccaatctg---attaggccaactatatattgaattggtgtgaagaatatatgactatcgcccatcactagtgaaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41735038 |
accaaggttggcatatggtagattaccaatctgatcattaggccaactatatattgaattggtgtgaagaatatatgactatcgcccatcactagtgcaa |
41735137 |
T |
 |
| Q |
198 |
aatgggaattac |
209 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41735138 |
aatgggaattac |
41735149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University