View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9549_low_41 (Length: 209)
Name: NF9549_low_41
Description: NF9549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9549_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 42951604 - 42951425
Alignment:
| Q |
17 |
acctcatatatgctcaaaactgcgaaaataaaatacataatcaaaaacgtgttttcaataattaaaaatcacattttatgtggtggattaagaaattatt |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
42951604 |
acctcatatatgctcaaaactgcaaaaataaaatacataatcaaaaacgtgtttccaataattaaaaatcacactttatgtagtggattaagaaattatc |
42951505 |
T |
 |
| Q |
117 |
gattaaaattagatagtaaagttcgggttggaatcctctaactttgtggagggaatttccctctacatttctctctatctct |
198 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42951504 |
gattaaaattaaatagtaaagttc-ggttgggatcctctaactttgtggagggaa-ttccctctacatttctctctatctct |
42951425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University