View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9549_low_42 (Length: 208)
Name: NF9549_low_42
Description: NF9549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9549_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 16903069 - 16902900
Alignment:
| Q |
15 |
agcaaaggggtgtaagcttaaatgtttttcttttgatttggtatcaaatgattatatatgctccagtattaatttaagtaaataagtgattgaatgttac |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16903069 |
agcaaagtggtgtaagcttaaatgtttttcttttgatttggtatcaaatgattatatatgctccagtattaatttaagtaaataagtgattgaatgttac |
16902970 |
T |
 |
| Q |
115 |
tgacatgtgtcagactccgggcatacctaccttcgttttaaagtgtcgatgctacgtatcatatatgtat |
184 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16902969 |
tgacatgtgtcagactccggacatatctaccttcgttttaaagtgtcgatgctacgtaccatatatgtat |
16902900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University