View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9550_low_6 (Length: 240)
Name: NF9550_low_6
Description: NF9550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9550_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 45139258 - 45139082
Alignment:
| Q |
1 |
tttatttctagagtaaatgatcattttgattattgaatgtgtcatgtgttattgttaaagactctaaaattaacaaatgtcatgatatgattggattaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45139258 |
tttatttctagagtaaatgatcattttgattattgaatgtgtcatgtgttattgttaaagactctaaaattaacaaatgtcatgatatgattggattaca |
45139159 |
T |
|
| Q |
101 |
agcaaagtctagaaggtcacactttgttcttcagacattcacaaggagaaaagtcactatactttttgtttatgtta |
177 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
45139158 |
agcaaagtctaggaggtcacactttgttcttgagacattcataaggagaaaagtgactatacttcttgtttatgtta |
45139082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 177 - 224
Target Start/End: Complemental strand, 45124785 - 45124738
Alignment:
| Q |
177 |
attgaataataatagcattgaacacgtgtttataagtgagacaattct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45124785 |
attgaataataatagcattgaacacgtgtttataagtgagacaattct |
45124738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University