View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9550_low_7 (Length: 229)
Name: NF9550_low_7
Description: NF9550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9550_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 218
Target Start/End: Original strand, 10760479 - 10760681
Alignment:
| Q |
16 |
aaaacctcgtctcactcaagaaccggttcaactttactcgattaggcttcacgaacaaattgtacgttgtccaatccctccacgtggcgataatatatca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
10760479 |
aaaacctcgtctcactcaagaaccggttcaactttactcgattaggcttcacgaacaaattgtacgttgtccaatccctccacgtggtgagaatatatca |
10760578 |
T |
|
| Q |
116 |
cttatgataaaatccaacggtcccattaaaataaaaaagtcgtcaatccataattgggaaccactagtctacgaagctctcttcgatcacgacaacacca |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10760579 |
cttatgataaaatccaacggtcccattcaaataaaaaagtcgtcaatccataattgggaaccactagtctacgaagctctcttcgatcgcgacaacacca |
10760678 |
T |
|
| Q |
216 |
cca |
218 |
Q |
| |
|
||| |
|
|
| T |
10760679 |
cca |
10760681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University