View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_15 (Length: 267)
Name: NF9551_1D_low_15
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 4761022 - 4760836
Alignment:
| Q |
1 |
atatatagtcaaaattatcaatatttgtatgtctaagtggcaaataatttaaataaaaaagtggcaaagaatttagtttcctcaagtatatcaagttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4761022 |
atatatagtcaaaattatcaatatttgtatgtctaagtggcaaataatttcaataaaaaaatggcaaagaatttagtttcctcaagtatatcaagttcaa |
4760923 |
T |
|
| Q |
101 |
gttttgtgttagtaaaaagtttttattttattttaaggaaagtataaagtattcctaaattctgtgaatgaagaacatagacatgag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4760922 |
gttttgtgttagtaaaaagtttttattttattttaaggaaagtataaagtattcctaaattctgtgaatgaagaacatagacatgag |
4760836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 267
Target Start/End: Complemental strand, 4760802 - 4760756
Alignment:
| Q |
221 |
atgagtccgtccggctcaactcaaattaataaaaatttgatgagatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4760802 |
atgagtccgtccggctcaactcaaatcaataaaaatttgatgagatt |
4760756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University