View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_20 (Length: 263)
Name: NF9551_1D_low_20
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 55 - 263
Target Start/End: Complemental strand, 4760400 - 4760192
Alignment:
| Q |
55 |
tgaataatttgagatcttgtgtcataatatccacaattaactttatgaaagggacatcactgttctttgcatgtgcttattgtgctctgtatttcccctg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4760400 |
tgaataatttgagatcttgtgtcataatatccacaattaactttataaaagggacatcactgttctttgcatgtgcttattgtgctctgtatttcccctg |
4760301 |
T |
|
| Q |
155 |
tatttaaacttcacataacccttcaaatagtttcatcgattcattttctctcacttctcctctgttttcaaactcaaaaccacaaacaaatttataaaag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4760300 |
tatttaaacttcacataacccttcaaatagtttcatcgattcattttctctcacttctcctctgttttcaaactcaaaaccacaaacaaatttataaaag |
4760201 |
T |
|
| Q |
255 |
aaaaaccaa |
263 |
Q |
| |
|
||||||||| |
|
|
| T |
4760200 |
aaaaaccaa |
4760192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 44
Target Start/End: Complemental strand, 53788930 - 53788898
Alignment:
| Q |
12 |
atgaatgagagaagtatattggaataatagaat |
44 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
53788930 |
atgaatgagagaagtatagtggaataatagaat |
53788898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University