View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_22 (Length: 260)
Name: NF9551_1D_low_22
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_22 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 103 - 260
Target Start/End: Complemental strand, 35443146 - 35442989
Alignment:
| Q |
103 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
35443047 |
T |
 |
| Q |
203 |
gtttgtttggttacaaaatgctaaaaatacatatatttatgtaaaataagtggttaaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35443046 |
gtttgtttggttacaaaatgctaaaaatacatatatttatttaaaataagtggttaaa |
35442989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 9 - 105
Target Start/End: Complemental strand, 35443302 - 35443205
Alignment:
| Q |
9 |
aatgatatgatacacttcactcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35443302 |
aatgatatgatacacttcactcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt |
35443205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 227 - 256
Target Start/End: Original strand, 16780329 - 16780358
Alignment:
| Q |
227 |
aaatacatatatttatgtaaaataagtggt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16780329 |
aaatacatatatttatgtaaaataagtggt |
16780358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University