View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_28 (Length: 249)
Name: NF9551_1D_low_28
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 4761020 - 4761267
Alignment:
| Q |
1 |
tatgtgaataactttttatggaaatcttgactatatttgaaccaacatgatgtatcatataatagcattatttgtggaaatgtaatcaacaatccattgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4761020 |
tatgtgaataactttttatggaaatcttgactatatttgaaccaacatgatttatcatataatagcattatttgtggaaatgtaatcaacaatccattgg |
4761119 |
T |
 |
| Q |
101 |
tttatatctcattcttttaggtatactatttggttccttnnnnnnnnnnnnnggtattctatttggtacaatatcacttataacaggtctaacatagagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4761120 |
tttatatctcattcttttaggtatactatttggttcctt-caaaaaaaaaaaggtatgctatttggtacaatatcacttataacaggtctaacatagagt |
4761218 |
T |
 |
| Q |
201 |
ctttctccgcctcctaaccaaattttctttttgttgagcaatctcaacc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4761219 |
ctttctccgcctcctaaccaaattttctttttgttgagcaatctcaacc |
4761267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University