View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_30 (Length: 242)
Name: NF9551_1D_low_30
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 43411001 - 43410765
Alignment:
| Q |
13 |
cacaacacattcagatga---gaagttgtaagctagctag----gaggatggactgctgctgctgctgttgcggaaagtgtttggaagattgagagggga |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411001 |
cacaacacattcagatgatcagaagttgtaagctagctagctaggaggatggactgctgctgctgctgttgcggaaagtgtttggaagattgagagggga |
43410902 |
T |
 |
| Q |
106 |
agcttgaaaaagagagagtctaatggtacgtgtgtgagatgatgtgtgcaagtctttacattcttcaagatcagcatcacatgataacacaacccattct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410901 |
agcttgaaaaagagagagtctaatggtacgtgtgtgagatgatgtgtgcaagtctttacattcttcaagatcagcatcacatgataacacaacccattct |
43410802 |
T |
 |
| Q |
206 |
ccttcatcatccaaatattttagaaccaagttgttca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410801 |
ccttcatcatccaaatattttagaaccaagttgttca |
43410765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University