View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_32 (Length: 240)
Name: NF9551_1D_low_32
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 29 - 240
Target Start/End: Complemental strand, 52373615 - 52373404
Alignment:
| Q |
29 |
aaagagatacctgttttctccttttacgattcctttgtcacccgttcgaagaaaacacttacgaactgtgtttctgattcttgcatgaaaaacttctctt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373615 |
aaagagatacctgttttctccttttacgattcctttgtcacccgttcgaagaaaacacttacgaactgtgtttctgattcttgcatgaaaaacttctctt |
52373516 |
T |
 |
| Q |
129 |
gttaaagaagggtgaccaaggtaaccagaggcattacttggagatgaaacccaaatttctccttcaacaccatcttcaacagcttcaagtgtttcttcat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373515 |
gttaaagaagggtgaccaaggtaaccagaggcattacttggagatgaaacccaaatttctccttcaacaccatcttcaacagcttcaagtgtttcttcat |
52373416 |
T |
 |
| Q |
229 |
taacaaccatga |
240 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52373415 |
taacaaccatga |
52373404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University