View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_40 (Length: 219)
Name: NF9551_1D_low_40
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_40 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 41779620 - 41779418
Alignment:
| Q |
17 |
catcatggtggacatttcattgctactgatgatgatgatttgaattatgttggagggcagttttgtgtgtgggaagacatatgtaccgattacatgaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41779620 |
catcatggtggacatttcattgctactgatgatgatgaattggattatgttggagggcagttttgtgtgtgggaagacatatgtaccgattacatgaacc |
41779521 |
T |
 |
| Q |
117 |
gttttatgcttgctgatcttgtgaagagttgtgcttgctattttaaggtatcaaacatttggtgtttggattccgagttagggttcagaaaaggattgtt |
216 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41779520 |
gttttatgcttgctgatttcgtgaagagttgtgcttgctattttaaggtatcaaacatttggtgtttggattctgagttagggttcagaaaaggattgtt |
41779421 |
T |
 |
| Q |
217 |
tga |
219 |
Q |
| |
|
||| |
|
|
| T |
41779420 |
tga |
41779418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 5014191 - 5013989
Alignment:
| Q |
17 |
catcatggtggacatttcattgctactgatgatgatgatttgaattatgttggagggcagttttgtgtgtgggaagacatatgtaccgattacatgaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5014191 |
catcatggtggacatttcattgctactgatgatgatgaattggattatgttggagggcagttttgtgtgtgggaagacatatataccgattacatgaacc |
5014092 |
T |
 |
| Q |
117 |
gttttatgcttgctgatcttgtgaagagttgtgcttgctattttaaggtatcaaacatttggtgtttggattccgagttagggttcagaaaaggattgtt |
216 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5014091 |
gttttatgcttgctgatatcgtgaagagttgtgcttgctattttaaggtatcaaacatttggtgtttggattctgagttagggttcagaaaaggattgtt |
5013992 |
T |
 |
| Q |
217 |
tga |
219 |
Q |
| |
|
||| |
|
|
| T |
5013991 |
tga |
5013989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 35299240 - 35299442
Alignment:
| Q |
17 |
catcatggtggacatttcattgctactgatgatgatgatttgaattatgttggagggcagttttgtgtgtgggaagacatatgtaccgattacatgaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
35299240 |
catcatggtggacatttcattgctactgatgatgatgatttggattatgttggagggcagttttgtgtgtgggatgacatatgtaccgattacatcaacc |
35299339 |
T |
 |
| Q |
117 |
gttttatgcttgctgatcttgtgaagagttgtgcttgctattttaaggtatcaaacatttggtgtttggattccgagttagggttcagaaaaggattgtt |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35299340 |
gttttatgcttgttgatcttgtgaagagttgtgctcgctattttaaggtatcaaacatttggtgtttggattctgagttagggttcagaaaaggattgtt |
35299439 |
T |
 |
| Q |
217 |
tga |
219 |
Q |
| |
|
||| |
|
|
| T |
35299440 |
tga |
35299442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University