View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_50 (Length: 211)
Name: NF9551_1D_low_50
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_50 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 211
Target Start/End: Original strand, 3248944 - 3249147
Alignment:
| Q |
8 |
gagatgaagtcagaagttaatatgtgtcgaatgtctcccttaatggagtccatcattcgcgacaatgtcgataagtttacgctattccagttatgcctgc |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3248944 |
gagataaagtcagaagttaatatgtgtcgaatgtcgcccttaatggagtccatcattcgcgacaatgtcgataagtttacgctattccagttatgcctgc |
3249043 |
T |
 |
| Q |
108 |
atcatttgtctgtaaaacacattggcactgtttagataaacaatttaatgcatgtaaaatcacttgtagataaaaatagtttccttacctattcccagcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3249044 |
atcatttgtctgtaaaacacattggcactgtttagataaacaatttaatgcatgtaaaatcacttgtagataaaaatagtttccttacctattcccagcc |
3249143 |
T |
 |
| Q |
208 |
ttga |
211 |
Q |
| |
|
|||| |
|
|
| T |
3249144 |
ttga |
3249147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University